| Budget Amount *help |
¥3,600,000 (Direct Cost: ¥3,600,000)
Fiscal Year 2000: ¥1,000,000 (Direct Cost: ¥1,000,000)
Fiscal Year 1999: ¥2,600,000 (Direct Cost: ¥2,600,000)
|
|---|
| Research Abstract |
A true/renal tissue kallikrein, mK1, is one of the vast majority of the biologically active substances, detected in the granular convoluted tubule (GCT) of mouse submandibular gland (SMG). However, the exact distribution of mK1 has been problematical, since the kallikrein isozymes share high amino acid sequence homology, and the antisera against any particular kallikrein frequently cross-react with other members of this family. The investigator prepared the specific antiserum against mK1 and digoxigenin-labeled mK1 oligonucleoides in the term of this project, and obtained the findings, as follows.
1) Only a subset of GCT cells were immunostained in both sexes, demonstrating an unusual sexually dimorphic mosaic pattern of mK1 distribution in the GCTs.
2) It is clarified, using castrated or hypophysectomized animals, that the sexual dimorphism of cellular mosaic dsitribution of mK1 is under synergistic regulation of androgens and thyroid hormones.
3) To detect the presence of mK1 mRNA, the primer-up(ACCATCACAGATCAGTGGG) and -down(CCTCCTGAATGAGCACACCC) were designed, and Northern blot hybridization of mouse SMG, sublingual gland, kidney and liver revealed a sigle band corresponding to the mK1 mRNA.
4) Though the author were trying in situ hybridization several times, any satisfactory signals for mK1 mRNA have not been detected till now.
|
