| Budget Amount *help |
¥3,100,000 (Direct Cost: ¥3,100,000)
Fiscal Year 2005: ¥900,000 (Direct Cost: ¥900,000)
Fiscal Year 2004: ¥900,000 (Direct Cost: ¥900,000)
Fiscal Year 2003: ¥1,300,000 (Direct Cost: ¥1,300,000)
|
|---|
| Research Abstract |
I understood that N1-(2-(2-aminoethylamino)ethyl)ethane-1,2-diamine PA (222) and N1-(2-(2-(2-aminoethylamino)ethylamino)ethyl)ethane-1,2-diamine PA (2222) were easy to be connected in a minor groove of Z-DNA very much and stabilized Z-DNA as a minor groove binder very much. Furthermore, I crystallize at 4 degrees Celsius, 10 degrees Celsius, 20 degrees Celsius by the high salt density with these 11 kinds of polyamine and d(CG)3 as a complex and give the salt density at 20 degrees Celsius very much and crystallize. I examine a role for Z-DNA of polyamine, stabilization action in detail by examining these. I perform crystallization of a long chain of Z-DNA which it has been said to that the above-mentioned crystallization vs. eight bases is difficult till now if I understand stabilization mechanism. I think to clarify structure of DNA such as mixture type d(CGCGCGCGCGAATTCGCGCGCGCG)2, d(CGCGCGCGAATTCGCGCGCG)2 and d(CGCGCGAATTCGCGCG)2 of B type DNA and Z type DNA to clarify B-Z transfer m
… More
echanism, Z-B transfer mechanism. As for the structure of DNA of B-Z mixture type, crystallization is tried all over the world till now, but there is not a report besides an example of our crystallization. I think about letting we bury a cavity of the big minor groove that it is it in an element of destabilization with this polyamine with the polyamine which is a minor groove binder as DNA and a complex of these long chains and stabilize structure of the whole DNA. Therefore we succeed in X-ray crystallographic analysis of left-handed DNA of a long chain. As for the structure of DNA of B-Z mixture type, crystallization is tried all over the world till now, but there is not a report besides an example of our crystallization. The groove binder polyamine which it is crawled, and I discovered is connected in a minor groove of just Z-DNA and I bury a big minor groove and stabilize structure of the whole DNA. I apply this and perform crystallization of DNA of a long chain, crystallization of B-Z-B junction structure. I think that I bring big development in structured study of DNA if I have already succeeded in crystallization of the DNA which is the longest in the world with this method now, and structure or B-Z-B junction structure of DNA of a long chain are clarified in sequence Less
|
