| Research Abstract |
Gene analysis of rumen protozoa has not been explored. The happening of some unexpeted problems in the present study has delayd the accomplishment of our research plan. As a result, however, the present study reached for sure at the research field of gene analysis and a part of the gene of lysine-synthesizing enzyme (lysA : diaminopimelate decarboxylase) of Entodinium caudatum has been determined for the first time in the world. The results seemed meaningful as fundamental data for continuing the gene analysis of the rumen protozoa in future. The first problem we met at the beggining of this study was the origin of the protozoon to be used for purifying mRNA.The protozoon derived from an agnotobiotic culture gave us too small amount of mRNA to make cDNA.The protozoon collected from a monofaunated goat, to which only E.caudatum had been inoculated, gave us an enough amount of mRNA.After making cDNA library, screening of lysA gene was carried out at first with lysine-requiring mutant of E.coli. But the method was interrupted by disappearance of the response of the bacterium to lysin-deficiency. This was left as a pending issue. Then, considering the fact that the codon usage (especially, stop codon) of protozoa (ciliates) in general is different from the universal one, lysA gene of the protozoon was screened from the cDNA library using a probe with a sequence 5'TTAAATCTTGGAGGCGGATTC3', which had a high homology in lysA gene of several bacteria and labelled with digoxigenin, and positive plaques were detected. One of these plaques was cloned and the DNA sequence of the insert was determined by the chain termination method. The protozoon, E.caudatum, seemed to use TAA as a stop codon like Euplotes (one of ciliates) and different from other ciliated protozoa, and to use TGC for recognizing cysteine like other organisms and different from Euplotes which had known to use TGA for cysteine.
|
