1994 Fiscal Year Final Research Report Summary
Practical study of microsatellite polymorphisms
Project/Area Number |
05660319
|
Research Category |
Grant-in-Aid for General Scientific Research (C)
|
Allocation Type | Single-year Grants |
Research Field |
Applied animal science
|
Research Institution | Hokkaido University |
Principal Investigator |
UEDA Junji Faculty of Agriculture, Hokkaido University, Associate Prof., 農学部, 助教授 (50002374)
|
Project Period (FY) |
1993 – 1994
|
Keywords | Livestock / Pig / DNA / Microsatellite / PCR / Polymorphism |
Research Abstract |
Microsatellite being highly polymorphic have been suggested for useful markers to make linkage may in farm animals.Positive clones with microsatellite in swine genome were identified by hybridization with a non-isotopic(DIG) labelled probes inclucing murine (Ca)_n and swine (GT)_n repeat sequences which were amplified by PCR.Four microsatellites were detected by this method.Two pairs of primers were synthesized (MPH7F : 5'GATCTTTCCACTTAACCTTTTTGTC, MPH7R : 5'TTTATCATTGTAAGACAGATTTGTA ; MPH9F : 5'GGCAAACATTCAGACCAGAG,MPH9R : 5'GAATCTGTCCATAATCAAGG).Electrophoretic variations of these microsatellites were determined by these of polyacrylamide nondenaturing gels and ethidium bromide staining under exposure to UV radiation.This work clarified the non RI method of microsateilite cloning and detection procedures.
|
Research Products
(1 results)